Home › Categories › Business & Finance› Additional File 2:Supplementary Tables.(PDF 134 KB)

Additional File 2:Supplementary Tables.(PDF 134 KB).pdf

12918_2012_935_MOESM2_ESM.pdf
Preview of Additional file 2:Supplementary tables.(PDF 134 KB)
🔗 Source: static-content.springer.com
📊 Size: 133 KB
👤 Author: Ka Yee Yeung
⬇️ Downloads: 91

Summary

The construction of regulatory networks from time-series expression data is enhanced by integrating external biological knowledge. Various methods, including iBMA-prior, iBMA-shortlist, iBMA-size, and iBMA-noprior, are assessed based on their performance in inferring regulatory relationships. The results show that iBMA-prior and iBMA-size outperform other methods, with higher true positive rates (TPR) and observed-to-expected (O/E) ratios. The assessment is based on the time-series yeast gene expression data and the Yeastract database. The methods are also evaluated at different posterior probability thresholds, and the results indicate that iBMA-prior and iBMA-size maintain their superior performance across various thresholds. Additionally, the estimated regression coefficients and posterior probabilities for each external data type are provided, highlighting the importance of incorporating external biological knowledge in the construction of regulatory networks. The area under the precision-recall curve (PRC) is also calculated for iBMA-based methods, further demonstrating their effectiveness in inferring regulatory relationships.

Download File

Description

The construction of regulatory networks from time-series expression data is enhanced by integrating external biological knowledge.

Technical Information

  • File Format: PDF
  • File Size: 133 KB
  • Pages: 5
  • Language: EN
  • Author: Ka Yee Yeung
  • Total Downloads: 91
  • Last Updated: 1 month ago

Document Overview

This PDF document about Additional file 2:Supplementary tables.(PDF 134 KB) provides comprehensive information and guidance. Whether you're a beginner or advanced user, this resource offers valuable insights into Additional file 2:Supplementary tables.(PDF 134 KB).

Related Topics

If you're interested in Additional file 2:Supplementary tables.(PDF 134 KB), you might also want to explore:

Additional guideAdditional tutorialfile guidefile tutorial2:Supplementary guide2:Supplementary tutorialtables.(PDF guidetables.(PDF tutorial

Related Categories

Education & Learning
22711 documents
Health & Wellness
8956 documents
Technology
4783 documents

Related Documents

Preview of Additional file 1: Supplementary Table S1.
PDF file

Additional file 1: Supplementary Table S1.

1.33 MBEN1 page
sgTRPM7 (CAAATATAAGTGCCACCACA), sgORAI1 (CAACGTGCACAATCTCAACT), sgSTIM1 (CTCAGTATGAGGAGACCTTC), sgMGEA5 (GGTGTGGATAGCAACGTAGT), sgITGA4...
Download
Preview of Gabarito 2019
PDF file

Gabarito 2019

163 KBPT1 page
136-D, 137-B, 138-E, 139-B, 140-A, 141-C, 142-A, 143-B, 144-C, 145-D, 146-B, 147-A, 148-B, 149-E, 150-C, 151-E, 152-E, 153-E, 154-D, 155-C, 156-B,...
Download
Preview of Gabarito do 2º dia
PDF file

Gabarito do 2º dia

147 KBPT1 page
2° DIA - CADERNO 5 – Amarelo MATEMÁTICA E SUAS TECNOLOGIAS...
Download
Preview of Additional file 14: Table S13.
PDF file

Additional file 14: Table S13.

246 KBDenise SheerEN2 pages
Researchers identified a tumor-specific hypomethylation signature in pilocytic astrocytomas, a type of pediatric low-grade astrocytoma, through DNA...
Download
Preview of Additional file 2.
PDF file

Additional file 2.

98 KBLiz NorsaEN1 page
Arabic and Bangla speakers showed improvements in DASS21 and K10 categories post-program.
Download

Download Additional file 2:Supplementary tables.(PDF 134 KB) eBooks for free and learn more about Additional file 2:Supplementary tables.(PDF 134 KB). These books contain exercises and tutorials to improve your practical skills, at all levels!

Not satisfied with this document? We have related documents to Additional file 2:Supplementary tables.(PDF 134 KB), try searching with similar keywords: Supplementary Figures, Supplementary Tables, Supplementary Notes and Supplementary References, Supplementary Figures Supplementary Tables Supplementary Notes And Supplementary References, Additional file 2:Supplementary tables.(PDF 134 KB), betomix 134 listes des fichiers pdf betomix 134 betomix 134, Additional file 1: In Pdf format includes Supplementary Figures 1–6.(PDF 591 KB), Additional file 1: Supplementary Table S1., 2013 Grade 12 Supplementary Supplementary Question, Description of Additional Supplementary Files

You can download PDF versions of the user's guide, manuals and ebooks about Additional file 2:Supplementary tables.(PDF 134 KB), you can also find and download for free A free online manual (notices) with beginner and intermediate, Downloads Documentation, You can download PDF files (or DOC and PPT) about Additional file 2:Supplementary tables.(PDF 134 KB) for free, but please respect copyrighted ebooks.