Home › Categories › Business & Finance› Supplementary File

Supplementary File.pdf

JPRA-1-101s.pdf
Preview of Supplementary File
🔗 Source: scitechnol.com
📊 Size: 35 KB
📄 Pages: 2 pages
⬇️ Downloads: 28

Summary

The correlation function 'T T is determined via expansion of fluctuations into the Fourier series, given by ∑∑∑ α β γ f αβγ exp(iαx + iβy + iγz). The correlation function takes the form ∫∫∫ dx dy dz T(x, y, z) T(x', y', z') = ∑∑∑ α β γ φ αβγ exp(iα(x - x') + iβ(y - y') + iγ(z - z')). Integrals of certain types are zero, while others equal 1 at specific conditions, resulting in the correlation function expression ∑∑∑ α β γ φ αβγ * exp(iα(x - x') + iβ(y - y') + iγ(z - z')). Any correlation function can be found by a similar formula.

Download File

Description

The correlation function 'T T is determined via expansion of fluctuations into the Fourier series, given by ∑∑∑ α β γ f αβγ exp(iαx + iβy + iγz).

Technical Information

  • File Format: PDF
  • File Size: 35 KB
  • Pages: 2
  • Language: EN
  • Total Downloads: 28
  • Last Updated: 1 week ago

Document Overview

This PDF document about Supplementary File provides comprehensive information and guidance. Whether you're a beginner or advanced user, this resource offers valuable insights into Supplementary File.

Related Topics

If you're interested in Supplementary File, you might also want to explore:

Supplementary guideSupplementary tutorialFile guideFile tutorial

Related Categories

Education & Learning
22711 documents
Health & Wellness
8956 documents
Technology
4783 documents

Related Documents

Preview of Supplementary file 1
PDF file

Supplementary file 1

7.12 MBEN69 pages
The SensorOverlord predicts the accuracy of measurements with ratiometric biosensors.
Download
Preview of Description of Additional Supplementary Files
PDF file

Description of Additional Supplementary Files

34 KBAshley Lynn BergEN1 page
Supplementary Data 1, contains plot and tree information, and response variable data including CO2 and N2O fluxes, cumulative fluxes, dissolved...
Download
Preview of Description of Additional Supplementary Files
PDF file

Description of Additional Supplementary Files

60 KBNathan ReevesEN1 page
1. Primer sequences for qPCR, semi-qPCR, ChIP-qPCR, and PCR (Supplementary Data 1), 2. sgRNA sequences (Supplementary Data 2), 3.
Download
Preview of Additional file 1: Supplementary Table S1.
PDF file

Additional file 1: Supplementary Table S1.

1.33 MBEN1 page
sgTRPM7 (CAAATATAAGTGCCACCACA), sgORAI1 (CAACGTGCACAATCTCAACT), sgSTIM1 (CTCAGTATGAGGAGACCTTC), sgMGEA5 (GGTGTGGATAGCAACGTAGT), sgITGA4...
Download
Preview of Fire File Certificate
PDF file

Fire File Certificate

137 KBJaneEN1 page
The Phoenix FS2260K/E/F World Class Vertical Fire File Series provides 90 minutes fire protection for paper documents and 60 minutes for digital...
Download

Download Supplementary File eBooks for free and learn more about Supplementary File. These books contain exercises and tutorials to improve your practical skills, at all levels!

Not satisfied with this document? We have related documents to Supplementary File, try searching with similar keywords: Supplementary Figures, Supplementary Tables, Supplementary Notes and Supplementary References, Supplementary Figures Supplementary Tables Supplementary Notes And Supplementary References, 2013 Grade 12 Supplementary Supplementary Question, Share Ebook Grammar File 1 9 Supplementary Exercises, new english file intermediate supplementary resources, Supplementary file 1, Additional file 1: In Pdf format includes Supplementary Figures 1–6.(PDF 591 KB), Supplementary File

You can download PDF versions of the user's guide, manuals and ebooks about Supplementary File, you can also find and download for free A free online manual (notices) with beginner and intermediate, Downloads Documentation, You can download PDF files (or DOC and PPT) about Supplementary File for free, but please respect copyrighted ebooks.