Home › Categories › Business & Finance› Description Of Additional Supplementary Files

Description Of Additional Supplementary Files.pdf

41467_2019_10831_MOESM3_ESM.pdf
Preview of Description of Additional Supplementary Files
🔗 Source: static-content.springer.com
📊 Size: 60 KB
👤 Author: Nathan Reeves
⬇️ Downloads: 38

Summary

1. Primer sequences for qPCR, semi-qPCR, ChIP-qPCR, and PCR (Supplementary Data 1),
2. sgRNA sequences (Supplementary Data 2),
3. shRNA sequences (Supplementary Data 3),
4. Information on dental pulp-derived primary hMSCs (Supplementary Data 4),
5. Differentially expressed miRNAs between WT and DR8dex2 hMSCs (Supplementary Data 5),
6. Interacting proteins of DGCR8 identified by mass spectrometry (Supplementary Data 6),
7. Downregulated and upregulated genes by RNA-seq of mouse joints treated with lentiviruses (Supplementary Data 7).

Download File

Description

1. Primer sequences for qPCR, semi-qPCR, ChIP-qPCR, and PCR (Supplementary Data 1),
2. sgRNA sequences (Supplementary Data 2),
3.

Technical Information

  • File Format: PDF
  • File Size: 60 KB
  • Pages: 1
  • Language: EN
  • Author: Nathan Reeves
  • Total Downloads: 38
  • Last Updated: 1 week ago

Document Overview

This PDF document about Description of Additional Supplementary Files provides comprehensive information and guidance. Whether you're a beginner or advanced user, this resource offers valuable insights into Description of Additional Supplementary Files.

Related Topics

If you're interested in Description of Additional Supplementary Files, you might also want to explore:

Description guideDescription tutorialAdditional guideAdditional tutorialSupplementary guideSupplementary tutorialFiles guideFiles tutorial

Related Categories

Education & Learning
22711 documents
Health & Wellness
8956 documents
Technology
4783 documents

Related Documents

Preview of Description of Additional Supplementary Files
PDF file

Description of Additional Supplementary Files

34 KBAshley Lynn BergEN1 page
Supplementary Data 1, contains plot and tree information, and response variable data including CO2 and N2O fluxes, cumulative fluxes, dissolved...
Download
Preview of Additional file 1: Supplementary Table S1.
PDF file

Additional file 1: Supplementary Table S1.

1.33 MBEN1 page
sgTRPM7 (CAAATATAAGTGCCACCACA), sgORAI1 (CAACGTGCACAATCTCAACT), sgSTIM1 (CTCAGTATGAGGAGACCTTC), sgMGEA5 (GGTGTGGATAGCAACGTAGT), sgITGA4...
Download
Preview of Supplementary File
PDF file

Supplementary File

35 KBEN2 pages
The correlation function 'T T is determined via expansion of fluctuations into the Fourier series, given by ∑∑∑ α β γ f αβγ exp(iαx + iβy + iγz).
Download
Preview of Additional file 2:Supplementary tables.(PDF 134 KB)
PDF file

Additional file 2:Supplementary tables.(PDF 134 KB)

133 KBKa Yee YeungEN5 pages
The construction of regulatory networks from time-series expression data is enhanced by integrating external biological knowledge.
Download
Preview of Additional file 1
PDF file

Additional file 1

36 KBEN2 pages
Researchers analyzed European Court of Human Rights (ECHR) decisions from a grand chamber, chamber, or commission, considering only decisions made...
Download

Download Description of Additional Supplementary Files eBooks for free and learn more about Description of Additional Supplementary Files. These books contain exercises and tutorials to improve your practical skills, at all levels!

Not satisfied with this document? We have related documents to Description of Additional Supplementary Files, try searching with similar keywords: Supplementary Figures, Supplementary Tables, Supplementary Notes and Supplementary References, Supplementary Figures Supplementary Tables Supplementary Notes And Supplementary References, Description of Additional Supplementary Files, 2013 Grade 12 Supplementary Supplementary Question, Additional file 1: In Pdf format includes Supplementary Figures 1–6.(PDF 591 KB), Additional file 2:Supplementary tables.(PDF 134 KB), Additional file 1: Supplementary Table S1., Additional Benefits Additional Parts† Mechanical

You can download PDF versions of the user's guide, manuals and ebooks about Description of Additional Supplementary Files, you can also find and download for free A free online manual (notices) with beginner and intermediate, Downloads Documentation, You can download PDF files (or DOC and PPT) about Description of Additional Supplementary Files for free, but please respect copyrighted ebooks.